Clone: ScCD00010569

Clone ID:ScCD00010569
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID FLH114302.01X
HIP Master Clone ID 90148
HIP Clone ID 114302

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1749 Saccharomyces cerevisiae CLOSED Genomic DNA template YLR133W CKI1 choline kinase
Insert1
Size (bp)1749
SpeciesSaccharomyces cerevisiae
FormatCLOSED
Tissue SourceGenomic DNA template
Species Specific ID YLR133W
Gene SymbolCKI1
Gene Namecholine kinase
Keyword

Insert Sequence:

ATGGTACAAGAATCACGTCCAGGGAGTGTAAGAAGTTACTCGGTCGGTTACCAAGCAAGGTCCAGATCGAGTTCTCAAAGAAGACATTCGTTAACACGCCAACGTTCCTCGCAAAGACTGATTAGAACCATCAGTATCGAGTCTGATGTGTCTAATATTACTGACGATGACGATTTGAGAGCTGTCAATGAGGGAGTAGCGGGTGTGCAACTGGACGTCTCTGAAACCGCAAATAAGGGACCAAGAAGAGCATCAGCAACTGATGTCACAGATAGTTTGGGTTCGACTTCGTCGGAATATATTGAGATTCCCTTTGTTAAGGAAACATTGGATGCAAGTTTACCTTCGGATTATCTGAAGCAGGACATATTAAATCTCATTCAGAGTTTGAAGATATCCAAATGGTATAACAACAAGAAAATCCAACCGGTAGCACAAGATATGAACTTAGTCAAGATCTCTGGTGCGATGACAAACGCAATTTTCAAAGTTGAATACCCTAAGTTACCATCGTTGCTATTGAGAATATACGGACCGAATATTGATAATATCATTGACAGGGAATATGAATTGCAGATTTTGGCTAGGCTTTCATTGAAAAATATAGGTCCTTCCCTTTACGGCTGTTTTGTAAACGGTAGATTTGAGCAGTTTCTGGAGAATTCTAAGACTTTAACAAAAGACGACATTAGAAACTGGAAGAACTCTCAAAGGATTGCAAGGAGAATGAAGGAGTTACATGTAGGTGTTCCTCTCTTGAGTTCAGAAAGGAAGAACGGGTCGGCTTGTTGGCAAAAGATTAACCAGTGGTTGCGCACGATTGAGAAAGTCGACCAATGGGTGGGGGATCCTAAAAACATTGAAAACTCTTTATTATGTGAGAATTGGTCCAAGTTTATGGATATTGTCGATAGATATCACAAGTGGCTTATTTCTCAAGAACAGGGTATAGAGCAAGTCAACAAAAATCTTATATTCTGCCATAATGATGCCCAATACGGCAATTTACTTTTCACTGCTCCTGTGATGAACACACCGAGCCTATACACTGCACCTTCGTCTACATCATTGACTTCCCAATCAAGTTCCTTATTTCCTTCGAGCTCCAATGTCATTGTAGATGATATAATCAACCCGCCAAAGCAGGAGCAAAGCCAAGATTCCAAATTGGTCGTCATTGATTTTGAATATGCAGGTGCCAATCCCGCCGCATATGATTTAGCGAATCATCTTTCCGAGTGGATGTATGATTACAACAATGCTAAGGCCCCACATCAGTGCCACGCTGATAGATATCCCGATAAAGAACAGGTTTTGAATTTCTTATACTCTTATGTTTCGCATCTAAGGGGTGGTGCTAAGGAACCCATAGATGAAGAGGTTCAAAGACTCTATAAGTCAATCATTCAATGGAGACCCACTGTACAACTATTTTGGTCGCTCTGGGCCATCCTACAAAGTGGTAAATTAGAGAAAAAAGAAGCCTCCACTGCCATCACTAGAGAAGAAATTGGACCCAATGGAAAAAAATATATCATCAAGACTGAACCCGAATCCCCTGAAGAAGACTTTGTTGAAAATGACGACGAGCCTGAAGCTGGCGTCAGCATTGACACGTTCGATTATATGGCTTATGGTCGTGACAAGATTGCGGTCTTTTGGGGCGACCTCATTGGCTTAGGCATAATCACCGAAGAAGAATGCAAAAATTTCAGCTCTTTCAAGTTCCTCGATACTAGTTATTTGTAA

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1749
Start on reference sequence 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

TTTTGATTGATTGTACAGGAAAATATACATCGCAGGGGGTTGACTTTTACCATTTCACCGCAATGGAATCAAACTTGTTGAAGAGAATGTTCACAGGCGCATACGCTACAATGACCCGATTCTTGCTAGCCTTTTCTCGGTCTTGCAAACAACCGCCGGCAGCTTAGTATATAAATACACATGTACATACCTCTCTCCGTATCCTCGTAATCATTTTCTTGTATTTATCGTCTTTTCGCTGTAAAAACTTTATCACACTTATCTCAAATACACTTATTAACCGCTTTTACTATTATCTTCTACGCTGACAGTAATATCAAACAGTGACACATATTAAACACAGTGGTTTCTTTGCATAAACACCATCAGCCTCAAGTCGTCAAGTAAAGATTTCTTGTTCATGCAGATAGATAACAATCTATATGTTGATAATTAGCGTTGCCTCATCAATGCGAGATCCGTTTAACCGGACCCTAGTGCACTTACCCCACGTTCGGTCCACTGTGTGCCGAACATGCTCCTTCACTATTTTAACATGTGGAATTAATTCTCATGTTTGACAGCTTATCATCGAACTCTAAGAGGTGATACTTATTTACTGTAAAACTGTGACGATAAAACCGGAAGGAAGAATAAGAAAACTCGAACTGATCTATAATGCCTATTTTCTGTAAAGAGTTTAAGCTATGAAAGCCTCGGCATTTTGGCCGCTCCTAGGTAGTGCTTTTTTTCCAAGGACAAAACAGTATCTTTTTCTTGAGCAGGTTTTATGTTTCGGTAATCATAAACAATAAATAAATTAATTCATTTATGTTTAAAAATAAAAAGAGCCTCGGCATTTGGCCGCTCCTAGGTAGGCTTTTTTCCAGGGCCAAACAGTTTTTTTTTCTGAGCAGGTTTATGTTCGGTAATCATAAACAATAAATAAATTATTCATTTTTTTTAAAAATAAAAAATAAAAAAGTATTTTAAATTTTTAAAAAAGTTGATTATAAGCATGTGACCTTTTGCAAGCAATTAAATTTTGCAATTTGTGATTTAGGCAAAAGTTACTATTTCTGGCTCGTGTAATATATGTATGCTAATGTGAACTTTTACAAAGTCGATATGGACTTAGTCAAAAGAAATTTTCTTAAAAATATATAGCACTAGCCAATTTAGCACTTCTTTATGAGATATATTATAGACTTTATTAAGCCAGATTTGTGTATTATATGTATTTACCCGGCGAATCATGGACATACATTCTGAAATAGGTAATATTCTCTATGGTGAGACAGCATAGATAACCTAGGATACAAGTTAAAAGCTAGTACTGTTTTGCAGTAATTTTTTTCTTTTTTATAAGAATGTTACCACCTAAATAAGTTATAAAGTCAATAGTTAAGTTTGATATTTGATTGTAAAATACCGTAATATATTTGCATGATCAAAAGGCTCAATGTTGACTAGCCAGCATGTCAACCACTATATTGATCACCGATATTAGGACTTCCACACCAACTAGTAATATGACAATAAATTCAAGATATTCTTCATGAGAATGGCCCAGCGATTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACATCGAATTAATTCCTTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCCTCTAGAGTCGACCATCACAAGTTTGTACAAAAAAGCAGGCTCCACCATGGTACAAGAATCACGTCCAGGGAGTGTAAGAAGTTACTCGGTCGGTTACCAAGCAAGGTCCAGATCGAGTTCTCAAAGAAGACATTCGTTAACACGCCAACGTTCCTCGCAAAGACTGATTAGAACCATCAGTATCGAGTCTGATGTGTCTAATATTACTGACGATGACGATTTGAGAGCTGTCAATGAGGGAGTAGCGGGTGTGCAACTGGACGTCTCTGAAACCGCAAATAAGGGACCAAGAAGAGCATCAGCAACTGATGTCACAGATAGTTTGGGTTCGACTTCGTCGGAATATATTGAGATTCCCTTTGTTAAGGAAACATTGGATGCAAGTTTACCTTCGGATTATCTGAAGCAGGACATATTAAATCTCATTCAGAGTTTGAAGATATCCAAATGGTATAACAACAAGAAAATCCAACCGGTAGCACAAGATATGAACTTAGTCAAGATCTCTGGTGCGATGACAAACGCAATTTTCAAAGTTGAATACCCTAAGTTACCATCGTTGCTATTGAGAATATACGGACCGAATATTGATAATATCATTGACAGGGAATATGAATTGCAGATTTTGGCTAGGCTTTCATTGAAAAATATAGGTCCTTCCCTTTACGGCTGTTTTGTAAACGGTAGATTTGAGCAGTTTCTGGAGAATTCTAAGACTTTAACAAAAGACGACATTAGAAACTGGAAGAACTCTCAAAGGATTGCAAGGAGAATGAAGGAGTTACATGTAGGTGTTCCTCTCTTGAGTTCAGAAAGGAAGAACGGGTCGGCTTGTTGGCAAAAGATTAACCAGTGGTTGCGCACGATTGAGAAAGTCGACCAATGGGTGGGGGATCCTAAAAACATTGAAAACTCTTTATTATGTGAGAATTGGTCCAAGTTTATGGATATTGTCGATAGATATCACAAGTGGCTTATTTCTCAAGAACAGGGTATAGAGCAAGTCAACAAAAATCTTATATTCTGCCATAATGATGCCCAATACGGCAATTTACTTTTCACTGCTCCTGTGATGAACACACCGAGCCTATACACTGCACCTTCGTCTACATCATTGACTTCCCAATCAAGTTCCTTATTTCCTTCGAGCTCCAATGTCATTGTAGATGATATAATCAACCCGCCAAAGCAGGAGCAAAGCCAAGATTCCAAATTGGTCGTCATTGATTTTGAATATGCAGGTGCCAATCCCGCCGCATATGATTTAGCGAATCATCTTTCCGAGTGGATGTATGATTACAACAATGCTAAGGCCCCACATCAGTGCCACGCTGATAGATATCCCGATAAAGAACAGGTTTTGAATTTCTTATACTCTTATGTTTCGCATCTAAGGGGTGGTGCTAAGGAACCCATAGATGAAGAGGTTCAAAGACTCTATAAGTCAATCATTCAATGGAGACCCACTGTACAACTATTTTGGTCGCTCTGGGCCATCCTACAAAGTGGTAAATTAGAGAAAAAAGAAGCCTCCACTGCCATCACTAGAGAAGAAATTGGACCCAATGGAAAAAAATATATCATCAAGACTGAACCCGAATCCCCTGAAGAAGACTTTGTTGAAAATGACGACGAGCCTGAAGCTGGCGTCAGCATTGACACGTTCGATTATATGGCTTATGGTCGTGACAAGATTGCGGTCTTTTGGGGCGACCTCATTGGCTTAGGCATAATCACCGAAGAAGAATGCAAAAATTTCAGCTCTTTCAAGTTCCTCGATACTAGTTATTTGTAAGACCCAGCTTTCTTGTACAAAGTGGTGATGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGGGGGGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAGCTTTTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATTTCGGTTTCCTTGAAATTTTTTTGATTCGGTAATCTCCGAACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGTGTTGAAGAAACATGAAATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACATGCAGGAAACGAAGATAAATCATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAACTAAAAAACTGTATTATAAGTAAATGCATGTATACTAAACTCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCAATTCTCATGTTTGACAGCTTATCATCGATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGAATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTTCACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATTTCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAGAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGATGCGCTTAGATTAAAGGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACAAAATAGCAAATTTCGTCAAAAATGCTAAGAAATAGGTTATTACTGAGTAGTATTTATTTAAGTATTGTTTGTGCACTTGCCTGCAAGCCTTTTGAAAAGCAAGCATAAAAGATCTAAACATAAAATCTGTAAAATAACAAGATGTAAAGATAATGCTAAATCATTTGGCT

Vector Information:

Vector Name:pBY011
Type:bacterial plasmid
Description:Yeast expression vector with ARS1, CEN4, Gal1-10 promoter; amp resistance (URA3 for yeast); recombinational cloning.
Properties:Gateway, acceptor (destination), inducible expression, yeast expression, yeast shuttle
Comments:This is a bacteria-yeast shuttle vector useful for expressing cDNAs in yeast that includes an auxotrophic marker for selection in yeast.
Map:pBY011_map.pdf
Sequence:pBY011.txt
Size (bp):7920
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
yeast uracil

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
HIP Academic Institute