Clone: ScCD00101781

Clone ID:ScCD00101781
Is Verified:N
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Insert was fully sequenced in parent vector
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 468274
HIP Master Clone ID 90148
Original Clone ID FLH468274.01X

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1749 Saccharomyces cerevisiae CLOSED Genomic DNA template YLR133W CKI1 choline kinase
Insert1
Size (bp)1749
SpeciesSaccharomyces cerevisiae
FormatCLOSED
Tissue SourceGenomic DNA template
Species Specific ID YLR133W
Gene SymbolCKI1
Gene Namecholine kinase
Keyword

Insert Sequence:

ATGGTACAAGAATCACGTCCAGGGAGTGTAAGAAGTTACTCGGTCGGTTACCAAGCAAGGTCCAGATCGAGTTCTCAAAGAAGACATTCGTTAACACGCCAACGTTCCTCGCAAAGACTGATTAGAACCATCAGTATCGAGTCTGATGTGTCTAATATTACTGACGATGACGATTTGAGAGCTGTCAATGAGGGAGTAGCGGGTGTGCAACTGGACGTCTCTGAAACCGCAAATAAGGGACCAAGAAGAGCATCAGCAACTGATGTCACAGATAGTTTGGGTTCGACTTCGTCGGAATATATTGAGATTCCCTTTGTTAAGGAAACATTGGATGCAAGTTTACCTTCGGATTATCTGAAGCAGGACATATTAAATCTCATTCAGAGTTTGAAGATATCCAAATGGTATAACAACAAGAAAATCCAACCGGTAGCACAAGATATGAACTTAGTCAAGATCTCTGGTGCGATGACAAACGCAATTTTCAAAGTTGAATACCCTAAGTTACCATCGTTGCTATTGAGAATATACGGACCGAATATTGATAATATCATTGACAGGGAATATGAATTGCAGATTTTGGCTAGGCTTTCATTGAAAAATATAGGTCCTTCCCTTTACGGCTGTTTTGTAAACGGTAGATTTGAGCAGTTTCTGGAGAATTCTAAGACTTTAACAAAAGACGACATTAGAAACTGGAAGAACTCTCAAAGGATTGCAAGGAGAATGAAGGAGTTACATGTAGGTGTTCCTCTCTTGAGTTCAGAAAGGAAGAACGGGTCGGCTTGTTGGCAAAAGATTAACCAGTGGTTGCGCACGATTGAGAAAGTCGACCAATGGGTGGGGGATCCTAAAAACATTGAAAACTCTTTATTATGTGAGAATTGGTCCAAGTTTATGGATATTGTCGATAGATATCACAAGTGGCTTATTTCTCAAGAACAGGGTATAGAGCAAGTCAACAAAAATCTTATATTCTGCCATAATGATGCCCAATACGGCAATTTACTTTTCACTGCTCCTGTGATGAACACACCGAGCCTATACACTGCACCTTCGTCTACATCATTGACTTCCCAATCAAGTTCCTTATTTCCTTCGAGCTCCAATGTCATTGTAGATGATATAATCAACCCGCCAAAGCAGGAGCAAAGCCAAGATTCCAAATTGGTCGTCATTGATTTTGAATATGCAGGTGCCAATCCCGCCGCATATGATTTAGCGAATCATCTTTCCGAGTGGATGTATGATTACAACAATGCTAAGGCCCCACATCAGTGCCACGCTGATAGATATCCCGATAAAGAACAGGTTTTGAATTTCTTATACTCTTATGTTTCGCATCTAAGGGGTGGTGCTAAGGAACCCATAGATGAAGAGGTTCAAAGACTCTATAAGTCAATCATTCAATGGAGACCCACTGTACAACTATTTTGGTCGCTCTGGGCCATCCTACAAAGTGGTAAATTAGAGAAAAAAGAAGCCTCCACTGCCATCACTAGAGAAGAAATTGGACCCAATGGAAAAAAATATATCATCAAGACTGAACCCGAATCCCCTGAAGAAGACTTTGTTGAAAATGACGACGAGCCTGAAGCTGGCGTCAGCATTGACACGTTCGATTATATGGCTTATGGTCGTGACAAGATTGCGGTCTTTTGGGGCGACCTCATTGGCTTAGGCATAATCACCGAAGAAGAATGCAAAAATTTCAGCTCTTTCAAGTTCCTCGATACTAGTTATTTGTAA

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1749
Start on reference sequence 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

ATTGTCATTGAACTTGCCTGAAGAAGGTAAGGCCATTGAAGATGCAGTTAAAAAGGTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACCGAAGTCGGTGATGCTGTCGCCGAAGAAGTTAAGAAAATCCTTGCTTAAAAAGATTCTCTTTTTTTATGATATTTGTACATAAACTTTATAAATGAAATTCATAATAGAAACGACACGAAATTACAAAATGGAATATGTTCATAGGGTAGAATTAATTCTCATGTTTGACAGCTTATCATCGGATCGATCCAATATCAAAGGAAATGATAGCATTGAAGGATGAGACTAATCCAATTGAGGAGTGGCAGCATATAGAACAGCTAAAGGGTAGTGCTGAAGGAAGCATACGATACCCCGCATGGAATGGGATAATATCACAGGAGGTACTAGACTACCTTTCATCCTACATAAATAGACGCATATAAGTACGCATTTAAGCATAAACACGCACTATGCCGTTCTTCTCATGTATATATATATACAGGCAACACGCAGATATAGGTGCGACGTGAACAGTGAGCTGTATGTGCGCAGCTCGCGTTGCATTTTCGGAAGCGCTCGTTTTCGGAAACGCTTTGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGCTAGAAAGTATAGGAACTTCAGAGCGCTTTTGAAAACCAAAAGCGCTCTGAAGACGCACTTTCAAAAAACCAAAAACGCACCGGACTGTAACGAGCTACTAAAATATTGCGAATACCGCTTCCACAAACATTGCTCAAAAGTATCTCTTTGCTATATATCTCTGTGCTATATCCCTATATAACCTACCCATCCACCTTTCGCTCCTTGAACTTGCATCTAAACTCGACCTCTACATTTTTTATGTTTATCTCTAGTATTACTCTTTAGACAAAAAAATTGTAGTAAGAACTATTCATAGAGTGAATCGAAAACAATACGAAAATGTAAACATTTCCTATACGTAGTATATAGAGACAAAATAGAAGAAACCGTTCATAATTTTCTGACCAATGAAGAATCATCAACGCTATCACTTTCTGTTCACAAAGTATGCGCAATCCACATCGGTATAGAATATAATCGGGGATGCCTTTATCTTGAAAAAATGCACCCGCAGCTTCGCTAGTAATCAGTAAACGCGGGAAGTGGAGTCAGGCTTTTTTTATGGAAGAGAAAATAGACACCAAAGTAGCCTTCTTCTAACCTTAACGGACCTACAGTGCAAAAAGTTATCAAGAGACTGCATTATAGAGCGCACAAAGGAGAAAAAAAGTAATCTAAGATGCTTTGTTAGAAAAATAGCGCTCTCGGGATGCATTTTTGTAGAACAAAAAAGAAGTATAGATTCTTTGTTGGTAAAATAGCGCTCTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCTCGCGTTGCATTTTTGTTTTACAAAAATGAAGCACAGATTCTTCGTTGGTAAAATAGCGCTTTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCTCGCGTTGCATTTTTGTTCTACAAAATGAAGCACAGATGCTTCGTTAACAAAGATATGCTATTGAAGTGCAAGATGGAAACGCAGAAAATGAACCGGGGATGCGACGTGCAAGATTACCTATGCAATAGATGCAATAGTTTCTCCAGGAACCGAAATACATACATTGTCTTCCGTAAAGCGCTAGACTATATATTATTATACAGGTTCAAATATACTATCTGTTTCAGGGAAAACTCCCAGGTTCGGATGTTCAAAATTCAATGATGGGTAACAAGTACGATCCGATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGGTACCGCGGCCGCTCTAATGGCTTTGCTAATTGCTGATTGAAAGATATATGACCAATTAACTTGATGATTGCTATATGCGCGTTCTATTGAAGCAACGTGCAAGATGATCACTGCTTGGATTGACCTTGTTTTAGCAACAAGCCATACAAAGATATCAGACAGGAAAGTCACAGTCAAAGCATGCAAAAATCGACAAAGCAAACATAAGTAGAACCTGAGAACATCAACCATATGTCCTAATGAATTCAAGCACCCTCTTTTCCACCCAATTTGAGACATTTTCAAGATGTATTTATATTTTCGTGTACTGTGATATGACTTTATTCTTAGAATTTTTTATTGCCCGCGTAAGAAGGTGTTTAACAAGAGATCTTGTTAACTCACAAGGGTACTCTGACTGGATAGAAATCTTATTCTTGACCGGAAACTATCGAACTACAAAGAAAGAGCTTAGTTAATACAAATAAAAAAGTACAATGGAGCTCGGTAAACCTATTCCTAATCCTCTCCTAGGTTTAGATTCTACTGCTGCCGGCAAGCCCATCCCCAACCCCTTGCTTGGCTTGGACTCCACCGCCGCAGGAAAACCAATACCAAATCCACTTCTCGGACTTGATTCAACAACTAGTCATGTAGGATCAACAAGTTTGTACAAAAAAGCAGGCTCCACCATGGTACAAGAATCACGTCCAGGGAGTGTAAGAAGTTACTCGGTCGGTTACCAAGCAAGGTCCAGATCGAGTTCTCAAAGAAGACATTCGTTAACACGCCAACGTTCCTCGCAAAGACTGATTAGAACCATCAGTATCGAGTCTGATGTGTCTAATATTACTGACGATGACGATTTGAGAGCTGTCAATGAGGGAGTAGCGGGTGTGCAACTGGACGTCTCTGAAACCGCAAATAAGGGACCAAGAAGAGCATCAGCAACTGATGTCACAGATAGTTTGGGTTCGACTTCGTCGGAATATATTGAGATTCCCTTTGTTAAGGAAACATTGGATGCAAGTTTACCTTCGGATTATCTGAAGCAGGACATATTAAATCTCATTCAGAGTTTGAAGATATCCAAATGGTATAACAACAAGAAAATCCAACCGGTAGCACAAGATATGAACTTAGTCAAGATCTCTGGTGCGATGACAAACGCAATTTTCAAAGTTGAATACCCTAAGTTACCATCGTTGCTATTGAGAATATACGGACCGAATATTGATAATATCATTGACAGGGAATATGAATTGCAGATTTTGGCTAGGCTTTCATTGAAAAATATAGGTCCTTCCCTTTACGGCTGTTTTGTAAACGGTAGATTTGAGCAGTTTCTGGAGAATTCTAAGACTTTAACAAAAGACGACATTAGAAACTGGAAGAACTCTCAAAGGATTGCAAGGAGAATGAAGGAGTTACATGTAGGTGTTCCTCTCTTGAGTTCAGAAAGGAAGAACGGGTCGGCTTGTTGGCAAAAGATTAACCAGTGGTTGCGCACGATTGAGAAAGTCGACCAATGGGTGGGGGATCCTAAAAACATTGAAAACTCTTTATTATGTGAGAATTGGTCCAAGTTTATGGATATTGTCGATAGATATCACAAGTGGCTTATTTCTCAAGAACAGGGTATAGAGCAAGTCAACAAAAATCTTATATTCTGCCATAATGATGCCCAATACGGCAATTTACTTTTCACTGCTCCTGTGATGAACACACCGAGCCTATACACTGCACCTTCGTCTACATCATTGACTTCCCAATCAAGTTCCTTATTTCCTTCGAGCTCCAATGTCATTGTAGATGATATAATCAACCCGCCAAAGCAGGAGCAAAGCCAAGATTCCAAATTGGTCGTCATTGATTTTGAATATGCAGGTGCCAATCCCGCCGCATATGATTTAGCGAATCATCTTTCCGAGTGGATGTATGATTACAACAATGCTAAGGCCCCACATCAGTGCCACGCTGATAGATATCCCGATAAAGAACAGGTTTTGAATTTCTTATACTCTTATGTTTCGCATCTAAGGGGTGGTGCTAAGGAACCCATAGATGAAGAGGTTCAAAGACTCTATAAGTCAATCATTCAATGGAGACCCACTGTACAACTATTTTGGTCGCTCTGGGCCATCCTACAAAGTGGTAAATTAGAGAAAAAAGAAGCCTCCACTGCCATCACTAGAGAAGAAATTGGACCCAATGGAAAAAAATATATCATCAAGACTGAACCCGAATCCCCTGAAGAAGACTTTGTTGAAAATGACGACGAGCCTGAAGCTGGCGTCAGCATTGACACGTTCGATTATATGGCTTATGGTCGTGACAAGATTGCGGTCTTTTGGGGCGACCTCATTGGCTTAGGCATAATCACCGAAGAAGAATGCAAAAATTTCAGCTCTTTCAAGTTCCTCGATACTAGTTATTTGTAAGACCCAGCTTTCTTGTACAAAGTGGTTGATCCTATCTAGTTAGGTGAGTAAACAGGCCCCTTTTCCTTTGTCGATATCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCTCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTTAATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAAACGCGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAACTGTGGGAATACTCAGGTATCGTAAGATGCAAGAGTTCGAATCTCTTAGCAACCATTATTTTTTTCCTCAACATAACGAGAACACACAGGGGCGCTATCGCACAGACAAATTCGATGACTGGAAATTTTTTGTTAATTTCAGAGGTCGCCGCGCATATACCTTTTTCAACTGAAAAATTGGGAGAAAAAGGAAAGGTGAGAGGCCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCATGACTAAATGCTTGCATCACAATACTTGAAGTTGACAATATTATTTAAGGACCTATTGTTTTTTCCAATAGGTGGTTAGCAATCGTCTTATTCTAACTTTTCTTACCTTTTACATTTCAGCAATATATATATATATTTCAAGGATATACATTCTAATGTCTGCCCCTATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACCACGTTGGTCAAGATCACAGCCGAAGCCATTAAGGTTCTTAAAGCTATTTCTGATGTTCGTTCCAATGTCAAGTTCGATTTCGAAAATCATTTAATTGGTGGTGCTGCTATCGATGCTACAGGTGTCCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGTTGATGCCGTTTTGTTAGGTGCTGTGGGTGGTCCTAAATGGGGTACAGGTAGTGTTAGACCTGAACAAGGTTTACTAAAAATCCGTAAAGAACTTCAATTGTACGCCAACTTAAGACCATGTAACTTTGCATCCGACTCTCTTTTAGACTTATCTCCAATCAAGCCACAATTTGCTAAAGGTACTGACTTCGTTGTTGTCAGAGAATTAGTGGGAGGTATTTACTTTGGTAAGAGAAAGGAAGACGATGGTGATGGTGTCGCTTGGGATAGTGAACAATACACCGTTCCAGAAGTGCAAAGAATCACAAGAATGGCCGCTTTCATGGCCCTACAACATGAGCCACCATTGCCTATTTGGTCCTTGGATAAAGCTAATGTTTTGGCCTCTTCAAGATTATGGAGAAAAACTGTGGAGGAAACCATCAAGAACGAATTTCCTACATTGAAGGTTCAACATCAATTGATTGATTCTGCCGCCATGATCCTAGTTAAGAACCCAACCCACCTAAATGGTATTATAATCACCAGCAACATGTTTGGTGATATCATCTCCGATGAAGCCTCCGTTATCCCAGGTTCCTTGGGTTTGTTGCCATCTGCGTCCTTGGCCTCTTTGCCAGACAAGAACACCGCATTTGGTTTGTACGAACCATGCCACGGTTCTGCTCCAGATTTGCCAAAGAATAAGGTTGACCCTATCGCCACTATCTTGTCTGCTGCAATGATGTTGAA

Vector Information:

Vector Name:ZM552
Type:bacterial plasmid
Description:Yeast expression vectorn with N-terminal 3X V5 epitope tag; ampicillin and chloramphenicol resistance in bacteria; LEU2 resistance in yeast; Gateway cloning.
Properties:Gateway, with tag/fusion/marker, yeast expression
Comments:ZM511 Stu1 vector plus Gateway attR frame B cassette EcoRV fragment; same as ZM515
Map:
Sequence:ZM552.txt
Size (bp):8302
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y phage-resistant E. coli DH5-alpha strain used by HIP

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
yeast LEU2

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.