Clone: ScCD00101451

Clone ID:ScCD00101451
Is Verified:N
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Insert was fully sequenced in parent vector
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 468205
HIP Master Clone ID 1277
Original Clone ID FLH468205.01X

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2130 Saccharomyces cerevisiae CLOSED Genomic DNA template YDR146C SWI5 Transcription factor that activates transcription of genes expressed in G1 phase and at the G1/M boundary; localization to the nucleus occurs during G1 and appears to be regulated by phosphorylation by Cdc28p kinase
Insert1
Size (bp)2130
SpeciesSaccharomyces cerevisiae
FormatCLOSED
Tissue SourceGenomic DNA template
Species Specific ID YDR146C
Gene SymbolSWI5
Gene NameTranscription factor that activates transcription of genes expressed in G1 phase and at the G1/M boundary; localization to the nucleus occurs during G1 and appears to be regulated by phosphorylation by Cdc28p kinase
Keyword

Insert Sequence:

ATGGATACATCAAACTCTTGGTTTGATGCCTCAAAAGTACAAAGCCTAAATTTTGACCTACAAACCAACTCTTATTACTCAAATGCTAGAGGCAGTGACCCTTCGAGTTATGCAATAGAAGGCGAATATAAAACACTAGCAACAGATGATTTAGGCAATATATTGAACCTAAACTATGGTGAAACCAACGAAGTTATAATGAATGAAATAAATGACTTAAACCTTCCGCTGGGACCACTTTCTGATGAAAAATCTGTCAAGGTTTCTACTTTCTCCGAGTTAATAGGAAATGATTGGCAAAGTATGAACTTTGACTTAGAAAATAATTCAAGAGAAGTGACTCTAAATGCAACTAGCTTGTTGAATGAAAATAGATTAAATCAAGACAGTGGTATGACTGTTTATCAAAAAACAATGAGTGATAAGCCCCACGATGAAAAGAAGATTTCCATGGCGGATAATTTATTGTCGACTATAAACAAAAGTGAAATTAATAAAGGCTTCGATAGAAACCTCGGGGAATTACTGTTACAGCAACAACAAGAGTTGCGCGAGCAATTGAGAGCACAACAAGAGGCTAATAAGAAGTTAGAGTTAGAACTCAAACAAACACAATACAAGCAACAACAACTACAGGCTACCTTAGAGAACTCTGATGGTCCACAGTTTTTATCTCCCAAAAGGAAGATCTCTCCTGCTTCAGAAAATGTGGAGGATGTATACGCAAATAGCCTTTCACCAATGATTTCCCCACCAATGTCTAATACTTCGTTCACTGGGTCACCTTCTAGGAGAAACAATAGACAAAAGTACTGCCTGCAGAGAAAAAACTCTAGTGGTACTGTAGGACCACTATGTTTCCAGGAATTGAACGAAGGTTTCAATGACTCCCTCATTTCACCAAAGAAAATTCGCTCGAATCCAAATGAAAACCTCAGTTCAAAAACCAAATTTATTACGCCCTTCACTCCAAAGAGTAGAGTTAGTTCAGCTACGTCCAACTCTGCTAACATTACCCCTAATAACTTAAGGTTAGATTTCAAGATTAATGTTGAAGATCAGGAAAGCGAATATTCAGAGAAACCTTTGGGCCTGGGTATTGAACTTCTTGGAAAACCAGGTCCTTCTCCTACAAAATCAGTGTCTTTAAAGAGTGCTTCTGTGGATATTATGCCTACAATTCCTGGGTCTGTAAATAATACTCCATCAGTCAATAAAGTATCCCTTTCCTCCAGTTATATAGACCAATATACACCAAGAGGTAAGCAGTTACACTTTAGCTCTATCAGTGAGAATGCATTGGGTATCAATGCTGCGACACCACATCTAAAGCCGCCGAGCCAGCAAGCACGACATCGGGAAGGCGTTTTCAATGATTTAGACCCTAATGTACTTACGAAAAATACAGACAATGAAGGAGATGATAATGAGGAAAATGAGCCTGAAAGTAGATTTGTTATTTCCGAAACGCCTTCTCCCGTTCTTAAGTCACAAAGTAAGTACGAAGGAAGATCTCCTCAATTCGGCACACACATTAAGAAAATCAACACATATACCACAAATAGTCCCTCAAAAATCACAAGAAAACTCACAACACTGCCCAGAGGTTCAATCGATAAATATGTGAAGGAAATGCCTGATAAAACATTTGAATGTTTATTTCCTGGATGTACAAAAACATTCAAGAGAAGGTATAACATCAGATCTCATATTCAAACACATTTGGAAGATCGGCCATATTCCTGTGATCACCCTGGATGTGATAAGGCATTTGTACGAAATCATGACTTGATAAGACACAAAAAATCGCACCAAGAAAAGGCGTATGCATGTCCCTGTGGTAAGAAATTCAATAGAGAAGACGCTTTGGTTGTGCACAGAAGTAGAATGATTTGCAGCGGTGGTAAAAAGTATGAAAACGTGGTAATTAAAAGGTCTCCAAGAAAAAGAGGAAGACCAAGAAAAGATGGAACTTCAAGTGTTTCTAGTAGTCCAATCAAAGAAAATATTAACAAGGATCATAATGGACAGTTGATGTTCAAGCTTGAAGATCAACTCAGAAGAGAGCGTAGTTATGATGGGAATGGAACGGGGATTATGGTTTCGCCAATGAAAACTAATCAAAGGTAA

Insert Property: Insert 1

Type Value Extra Information
Discrepancy g1540a,E514K
End on reference sequence 2130
Start on reference sequence 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

ATTGTCATTGAACTTGCCTGAAGAAGGTAAGGCCATTGAAGATGCAGTTAAAAAGGTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACCGAAGTCGGTGATGCTGTCGCCGAAGAAGTTAAGAAAATCCTTGCTTAAAAAGATTCTCTTTTTTTATGATATTTGTACATAAACTTTATAAATGAAATTCATAATAGAAACGACACGAAATTACAAAATGGAATATGTTCATAGGGTAGAATTAATTCTCATGTTTGACAGCTTATCATCGGATCGATCCAATATCAAAGGAAATGATAGCATTGAAGGATGAGACTAATCCAATTGAGGAGTGGCAGCATATAGAACAGCTAAAGGGTAGTGCTGAAGGAAGCATACGATACCCCGCATGGAATGGGATAATATCACAGGAGGTACTAGACTACCTTTCATCCTACATAAATAGACGCATATAAGTACGCATTTAAGCATAAACACGCACTATGCCGTTCTTCTCATGTATATATATATACAGGCAACACGCAGATATAGGTGCGACGTGAACAGTGAGCTGTATGTGCGCAGCTCGCGTTGCATTTTCGGAAGCGCTCGTTTTCGGAAACGCTTTGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGCTAGAAAGTATAGGAACTTCAGAGCGCTTTTGAAAACCAAAAGCGCTCTGAAGACGCACTTTCAAAAAACCAAAAACGCACCGGACTGTAACGAGCTACTAAAATATTGCGAATACCGCTTCCACAAACATTGCTCAAAAGTATCTCTTTGCTATATATCTCTGTGCTATATCCCTATATAACCTACCCATCCACCTTTCGCTCCTTGAACTTGCATCTAAACTCGACCTCTACATTTTTTATGTTTATCTCTAGTATTACTCTTTAGACAAAAAAATTGTAGTAAGAACTATTCATAGAGTGAATCGAAAACAATACGAAAATGTAAACATTTCCTATACGTAGTATATAGAGACAAAATAGAAGAAACCGTTCATAATTTTCTGACCAATGAAGAATCATCAACGCTATCACTTTCTGTTCACAAAGTATGCGCAATCCACATCGGTATAGAATATAATCGGGGATGCCTTTATCTTGAAAAAATGCACCCGCAGCTTCGCTAGTAATCAGTAAACGCGGGAAGTGGAGTCAGGCTTTTTTTATGGAAGAGAAAATAGACACCAAAGTAGCCTTCTTCTAACCTTAACGGACCTACAGTGCAAAAAGTTATCAAGAGACTGCATTATAGAGCGCACAAAGGAGAAAAAAAGTAATCTAAGATGCTTTGTTAGAAAAATAGCGCTCTCGGGATGCATTTTTGTAGAACAAAAAAGAAGTATAGATTCTTTGTTGGTAAAATAGCGCTCTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCTCGCGTTGCATTTTTGTTTTACAAAAATGAAGCACAGATTCTTCGTTGGTAAAATAGCGCTTTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCTCGCGTTGCATTTTTGTTCTACAAAATGAAGCACAGATGCTTCGTTAACAAAGATATGCTATTGAAGTGCAAGATGGAAACGCAGAAAATGAACCGGGGATGCGACGTGCAAGATTACCTATGCAATAGATGCAATAGTTTCTCCAGGAACCGAAATACATACATTGTCTTCCGTAAAGCGCTAGACTATATATTATTATACAGGTTCAAATATACTATCTGTTTCAGGGAAAACTCCCAGGTTCGGATGTTCAAAATTCAATGATGGGTAACAAGTACGATCCGATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGGTACCGCGGCCGCTCTAATGGCTTTGCTAATTGCTGATTGAAAGATATATGACCAATTAACTTGATGATTGCTATATGCGCGTTCTATTGAAGCAACGTGCAAGATGATCACTGCTTGGATTGACCTTGTTTTAGCAACAAGCCATACAAAGATATCAGACAGGAAAGTCACAGTCAAAGCATGCAAAAATCGACAAAGCAAACATAAGTAGAACCTGAGAACATCAACCATATGTCCTAATGAATTCAAGCACCCTCTTTTCCACCCAATTTGAGACATTTTCAAGATGTATTTATATTTTCGTGTACTGTGATATGACTTTATTCTTAGAATTTTTTATTGCCCGCGTAAGAAGGTGTTTAACAAGAGATCTTGTTAACTCACAAGGGTACTCTGACTGGATAGAAATCTTATTCTTGACCGGAAACTATCGAACTACAAAGAAAGAGCTTAGTTAATACAAATAAAAAAGTACAATGGAGCTCGGTAAACCTATTCCTAATCCTCTCCTAGGTTTAGATTCTACTGCTGCCGGCAAGCCCATCCCCAACCCCTTGCTTGGCTTGGACTCCACCGCCGCAGGAAAACCAATACCAAATCCACTTCTCGGACTTGATTCAACAACTAGTCATGTAGGATCAACAAGTTTGTACAAAAAAGCAGGCTCCACCATGGATACATCAAACTCTTGGTTTGATGCCTCAAAAGTACAAAGCCTAAATTTTGACCTACAAACCAACTCTTATTACTCAAATGCTAGAGGCAGTGACCCTTCGAGTTATGCAATAGAAGGCGAATATAAAACACTAGCAACAGATGATTTAGGCAATATATTGAACCTAAACTATGGTGAAACCAACGAAGTTATAATGAATGAAATAAATGACTTAAACCTTCCGCTGGGACCACTTTCTGATGAAAAATCTGTCAAGGTTTCTACTTTCTCCGAGTTAATAGGAAATGATTGGCAAAGTATGAACTTTGACTTAGAAAATAATTCAAGAGAAGTGACTCTAAATGCAACTAGCTTGTTGAATGAAAATAGATTAAATCAAGACAGTGGTATGACTGTTTATCAAAAAACAATGAGTGATAAGCCCCACGATGAAAAGAAGATTTCCATGGCGGATAATTTATTGTCGACTATAAACAAAAGTGAAATTAATAAAGGCTTCGATAGAAACCTCGGGGAATTACTGTTACAGCAACAACAAGAGTTGCGCGAGCAATTGAGAGCACAACAAGAGGCTAATAAGAAGTTAGAGTTAGAACTCAAACAAACACAATACAAGCAACAACAACTACAGGCTACCTTAGAGAACTCTGATGGTCCACAGTTTTTATCTCCCAAAAGGAAGATCTCTCCTGCTTCAGAAAATGTGGAGGATGTATACGCAAATAGCCTTTCACCAATGATTTCCCCACCAATGTCTAATACTTCGTTCACTGGGTCACCTTCTAGGAGAAACAATAGACAAAAGTACTGCCTGCAGAGAAAAAACTCTAGTGGTACTGTAGGACCACTATGTTTCCAGGAATTGAACGAAGGTTTCAATGACTCCCTCATTTCACCAAAGAAAATTCGCTCGAATCCAAATGAAAACCTCAGTTCAAAAACCAAATTTATTACGCCCTTCACTCCAAAGAGTAGAGTTAGTTCAGCTACGTCCAACTCTGCTAACATTACCCCTAATAACTTAAGGTTAGATTTCAAGATTAATGTTGAAGATCAGGAAAGCGAATATTCAGAGAAACCTTTGGGCCTGGGTATTGAACTTCTTGGAAAACCAGGTCCTTCTCCTACAAAATCAGTGTCTTTAAAGAGTGCTTCTGTGGATATTATGCCTACAATTCCTGGGTCTGTAAATAATACTCCATCAGTCAATAAAGTATCCCTTTCCTCCAGTTATATAGACCAATATACACCAAGAGGTAAGCAGTTACACTTTAGCTCTATCAGTGAGAATGCATTGGGTATCAATGCTGCGACACCACATCTAAAGCCGCCGAGCCAGCAAGCACGACATCGGGAAGGCGTTTTCAATGATTTAGACCCTAATGTACTTACGAAAAATACAGACAATGAAGGAGATGATAATGAGGAAAATGAGCCTGAAAGTAGATTTGTTATTTCCGAAACGCCTTCTCCCGTTCTTAAGTCACAAAGTAAGTACGAAGGAAGATCTCCTCAATTCGGCACACACATTAAGAAAATCAACACATATACCACAAATAGTCCCTCAAAAATCACAAGAAAACTCACAACACTGCCCAGAGGTTCAATCGATAAATATGTGAAGGAAATGCCTGATAAAACATTTGAATGTTTATTTCCTGGATGTACAAAAACATTCAAGAGAAGGTATAACATCAGATCTCATATTCAAACACATTTGGAAGATCGGCCATATTCCTGTGATCACCCTGGATGTGATAAGGCATTTGTACGAAATCATGACTTGATAAGACACAAAAAATCGCACCAAGAAAAGGCGTATGCATGTCCCTGTGGTAAGAAATTCAATAGAGAAGACGCTTTGGTTGTGCACAGAAGTAGAATGATTTGCAGCGGTGGTAAAAAGTATGAAAACGTGGTAATTAAAAGGTCTCCAAGAAAAAGAGGAAGACCAAGAAAAGATGGAACTTCAAGTGTTTCTAGTAGTCCAATCAAAGAAAATATTAACAAGGATCATAATGGACAGTTGATGTTCAAGCTTGAAGATCAACTCAGAAGAGAGCGTAGTTATGATGGGAATGGAACGGGGATTATGGTTTCGCCAATGAAAACTAATCAAAGGTAAGACCCAGCTTTCTTGTACAAAGTGGTTGATCCTATCTAGTTAGGTGAGTAAACAGGCCCCTTTTCCTTTGTCGATATCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCTCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTTAATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAAACGCGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAACTGTGGGAATACTCAGGTATCGTAAGATGCAAGAGTTCGAATCTCTTAGCAACCATTATTTTTTTCCTCAACATAACGAGAACACACAGGGGCGCTATCGCACAGACAAATTCGATGACTGGAAATTTTTTGTTAATTTCAGAGGTCGCCGCGCATATACCTTTTTCAACTGAAAAATTGGGAGAAAAAGGAAAGGTGAGAGGCCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCATGACTAAATGCTTGCATCACAATACTTGAAGTTGACAATATTATTTAAGGACCTATTGTTTTTTCCAATAGGTGGTTAGCAATCGTCTTATTCTAACTTTTCTTACCTTTTACATTTCAGCAATATATATATATATTTCAAGGATATACATTCTAATGTCTGCCCCTATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACCACGTTGGTCAAGATCACAGCCGAAGCCATTAAGGTTCTTAAAGCTATTTCTGATGTTCGTTCCAATGTCAAGTTCGATTTCGAAAATCATTTAATTGGTGGTGCTGCTATCGATGCTACAGGTGTCCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGTTGATGCCGTTTTGTTAGGTGCTGTGGGTGGTCCTAAATGGGGTACAGGTAGTGTTAGACCTGAACAAGGTTTACTAAAAATCCGTAAAGAACTTCAATTGTACGCCAACTTAAGACCATGTAACTTTGCATCCGACTCTCTTTTAGACTTATCTCCAATCAAGCCACAATTTGCTAAAGGTACTGACTTCGTTGTTGTCAGAGAATTAGTGGGAGGTATTTACTTTGGTAAGAGAAAGGAAGACGATGGTGATGGTGTCGCTTGGGATAGTGAACAATACACCGTTCCAGAAGTGCAAAGAATCACAAGAATGGCCGCTTTCATGGCCCTACAACATGAGCCACCATTGCCTATTTGGTCCTTGGATAAAGCTAATGTTTTGGCCTCTTCAAGATTATGGAGAAAAACTGTGGAGGAAACCATCAAGAACGAATTTCCTACATTGAAGGTTCAACATCAATTGATTGATTCTGCCGCCATGATCCTAGTTAAGAACCCAACCCACCTAAATGGTATTATAATCACCAGCAACATGTTTGGTGATATCATCTCCGATGAAGCCTCCGTTATCCCAGGTTCCTTGGGTTTGTTGCCATCTGCGTCCTTGGCCTCTTTGCCAGACAAGAACACCGCATTTGGTTTGTACGAACCATGCCACGGTTCTGCTCCAGATTTGCCAAAGAATAAGGTTGACCCTATCGCCACTATCTTGTCTGCTGCAATGATGTTGAA

Vector Information:

Vector Name:ZM552
Type:bacterial plasmid
Description:Yeast expression vectorn with N-terminal 3X V5 epitope tag; ampicillin and chloramphenicol resistance in bacteria; LEU2 resistance in yeast; Gateway cloning.
Properties:Gateway, with tag/fusion/marker, yeast expression
Comments:ZM511 Stu1 vector plus Gateway attR frame B cassette EcoRV fragment; same as ZM515
Map:
Sequence:ZM552.txt
Size (bp):8302
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y phage-resistant E. coli DH5-alpha strain used by HIP

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
yeast LEU2

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.