Vector: pRSETC'

Name: pRSETC'
Description: Bacterial expression vector with a 5' 6xHis tag; ampicillian resistance in bacteria; restriction enzyme cloning
Synonyms: pRSETC'
Type: bacterial plasmid
Form: dsDNA
Size (bp):: 0
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Vector Map:
Vector Sequence:
Comments: Invitrogen vector. Additional vector information, map and sequence can be found on the invitrogen website.

Features:

Type Name Description Start Position End Position
primer site RSET FW primer 5' primer: AATACGACTCACTATAGGGAG 0 0
promoter T7 T7 promoter 0 0
bacterial origin f1 origin f1 origin 0 0
ribosome binding site RBS ribosome binding site 0 0
tag 6XHis N terminal 6xHis tag 0 0
selectable marker AmpR ampicillin resistance 0 0
protease cleavage site Enterokinase cleavage site Enterokinase cleavage site 0 0
MCS MSC Multiple cloning site 0 0
primer site T7 reverse primer T7 reverse priming site 0 0
bacterial origin pUC origin high replication origin in bacteria 0 0
tag Xpress(tm) epitope tag N-terminal epitope tag; allows detection of the fusion protein by the Xpress(tm) Antibody 0 0

Authors:

Author Name Author Type Creation Date
Invitrogen Commercial

Publications:

PMID Title

Parent Vector:

Name Comments